Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661676
Length 668 bp
Fasta Format > whkp10b02
gcaggggcagggcagggcacgctccgttatccaatccggcgtcctgcacg cacaccatgtaggccacaagatctcagatagcttatgtcattggtggtgg cataagctaccagtaccagctgcatgcctgtgctcttcttcgcttggagt gtgccctcggccatggcccgtgggcgcgtacgcagcaacccagggcatgg atccggcgttggctagctacctctggcctgcatcaagctgcagctggcta ggctgcttggtttcttgaggaagctcggggtgaaactgccatggctggcc ggcaggggcggcctcgtccacggcggcggcggcgacttctcacctctact aaggtagggcaacttctatcctttggcaattgtgacttctcgatcggtag ttgggcgtgatgatctctctcctccgagtagagcaccggtggagatcata gcacggtgcacgtgtgtgcgtatcctctgtatcgtcgtgtaactactagc tagctataccaagttgatatgaagctagtgtggttgtatgtgtgatcctg cttgagtcttttggttctgtgatctgtgggcagtatatgtgttgagtttt gtacgtatctggtaanactantgccatcantcnataaatataaatttgac gtttgcacaaaaaaaaaa
Download
page-top