Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661667
Length 803 bp
Fasta Format > whkp10a15
gcacacgcctacagagcagagtcttgctccttctcctgcctgtagagcat ccatcacgtacgttcacggacaaacatgtctccggtgaaggtgttcgggc atccgatgttgacaaacgtcgcacgggtgatgctcttcctggaggaggtc ggcgccgagtacgagctcgtgcccatcgacttcgtcgccggcgagcacaa gaggtcccaacacgtccagctaaacccgttcgcgaagatgcctgggttcc aagatggcgatctcgtcctgttcgagtcgcgcgccatcgccaagtacatc ctccgcaagtacggggggacagccggcctggacctcctcggagaaaacag cggaatcgaagaattagcagtggtggacatgtggacggaggtggaggccc agcagtactacccggccatctcgccggtggtgttcgagtgcatcatcatt cccttcatcatccctggcggtggcgcgacgccgaaccggagcgtcgtgga cgagagcctggagcggctgaggggtgtgctggggatctacgaggcccggc tggagaanagcagctacttggccggggactccatcagcttcgccgatctg aaccacatcccattcaccttctacttcatgaccaccccgtacgccaaggt gtttgatgagtaccccaaggtgaangcctggtgggagatgctcatggcca ngccggcggtgcanagggtctgcaancatatgcctaccgagtttaancta ngtgcgcantactanatgtctatgcactccncnccgggtgtgtgccntgc cng
Download
page-top