Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661666
Length 364 bp
Fasta Format > whkp10a14
tagctgcagcgtgccggatcgacgacaatgagctccacggaagccaccgt cgccggaggcctcttcgttgaggagacgaaggcgtggccggaggtggtgg ggaagtccatcaaggaggccagggagatcattctgaaggacaagcctgaa gccgacatcgtcgtcctcccagcaggggcaccggtcaccctggacttgag gcccaaccgtgtgcgcatctttgtcgacaccgtcgcggaaacacccttca ctggctaggcagctttgcaggcccgaaggaatgtatgcttgcaccatgca tgctcatgaatacgtttttatcaatggataaataaatgcaggcatgtaag cattaaaaaaaaaa
Download
page-top