Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661660
Length 692 bp
Fasta Format > whkp10a05
ctcctcatgctacttcatcgcccaaagtagctcgtccttctcttctccat ccactaacaccagccaagcgctgctctcctcttctcgcccacggtggcta ggcagccacttcctggctggcagcgccgacgtgtttgctgcaacagctgg ggcggtgacagcgtgctcgtcggtgcaccgggacaagggcggagtccccg tgccgtggtggtgtagctcaccccgattgtggctgcaggcaacggagccg gtgtgcagtggctcggttgctcgccagatctggcggccgaccatatgcca tgccagcgcgcgggggctgtggcggaggcgcggtaggcagggtggtgttg ctcgtctgccggtaggcgcggatgtgggagtgtcgaagttgcctccggtg aaagctcccacatgactgtaccatanacatccaaggctctctctccttct ttangattattanctcaaatggcaatttaactganacctttctttccatt atgcgcctctcctctttttgttcatttcnattggtgacgcataatacatg cnacaggcacctctcatcctctctttgttggcttgttgatcttgcaacnc atgaacgtatataantttgtaanatttcatgtaaaanancanggtgggac tattaatananatttgaaattttancacangcaaaaaaaaaa
Download
page-top