Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661659
Length 559 bp
Fasta Format > whkp10a04
cctctgcatcttcgcgtcgtcgtcttcacagcacagctcgaagctcgcgg ggaagcaaggatgccgaagcccgcgggggacgccaagctcctgatccagt ccctgaacaaggcctacgccgccacgcccacgaatctcaagatcattgac ctgtacgtggttttcgccgtcgcaactgccctggttcaggtcgtttacat gggaatagttgggtcattccccttcaactctttcctgtctggtgtcctgt catgcattggaactgcagtgcttggtgtttgcctccgtatccaagtcaac aaggacaacaaggaattcaaggatcttcccccggaaagagcctttgctga tttcgtcctgtgcaatctggtgctccacctggtgatcatgaacttcctcg gatgagcaactgtcatacaagctgtcgagactttgtagcgtcctaatgtc taagactgtcagcatgttagatattcatgtggcatcatacacagctatgt aatccgagagtttctctatgaactataagaattcagtggatttagcgtta aaaaaaaaa
Download
page-top