Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ553839
Length 669 bp
Fasta Format > rwhhg8j24
gcacttacagcagtattgatacatgtcacagtagagcccccggtgttccg atgagggcattctagaaaacagaccttaaaaatgacagaaacaccagtgc tggtattggttataatccattgtacatcacactttgtatgttcttagtga aagtattctgtctaatgtgttgtgatccacagccacaaggggagcagaaa tgcctacctagctatgtatctacagctcacccctgtgccttgctttgtac aaaccatggttctcttgtttcttctatatatagaaagtgaagttgtagta acaaaaaaatcattgaaaagcatgatagcaaagtatctgccgggtatggt tgatgaaaactctgcaagctttcattcccagatccattttccatctattg ccttaggcgtctggagcatgctgccggagcggctggtgctcgttgttctg gctgtcgagcggcatgtactgggacatgatggccatgatctccgagtcca tgtacgacctgagcctgtacttgtagaagatgaagccggcgacccctagg ccggcggcgcaggagacggcgaggagggcgacgagccagccgaacctgga catgctgttggccacgcagacgtcctccccgcggatgtacacctggttgc ccctgcagccgcactcgta
Download
page-top