Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ553761
Length 605 bp
Fasta Format > rwhhg8e16
atatatgaaatgacaataagaaacttagcactgactaccatacaacaaga ccagtgtagagcgtcgcttcaatatctaatgcttcttctcacttcccagg agcaacatgatcccgtcttgacgaacttgagaggcggcagaccaagagaa cgccatgctcttaggcagatgccttgtcgaacttgaggggcttcaccacc tcccaggtgaantcggcatcatcgcggccaaagtgaccgtaagcancggt cttgatgaacctgtttccncctttcttcaagtccaggttgatgctgatca tcccgggcctgaagtcaaagttctccttcacgagcttgaggatctccctg tcggggatcttgccggtgccgtaggagtcgacnaacacagacaaaggctc aggcacaccgatggcgtatgagatctgcacaatgcagcggcgtgcgaggc cgctggcgatgatgctcttggcggcctgcctggcaatgtaggcgccactg cggtcgaccttggttgggtccttgccagagaaggcaccgccgccgtgggc tccccagccaccataggtgtcgatgatgatcttgcggccggtgagaccgg cgtca
Download
page-top