Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ552155
Length 918 bp
Fasta Format > rwhhg20b21
gcaatgtactgtcctgtaaatcatcaggcaaaaggggagctacaagcctc attcatacacacttggaaaaccagcgaaaaggagcatgcatcgcgatgtg cggctgttctgggtggagacgagagtttctaaagagcggaaggtttcatt tattcaaaacatccagaggagcagctgcccttcgaatgtggatttacgcc aggcatgagtaggccaacgccttctcctctgacagctcctgggcggtcgc atccatcttcttcctcgagaactcatcgatcgggagcccttgaacaattg tccattcaccaccactgcacgttactgggaaggagtagataagaccagca ggcacaccgtatgaaccatcagagtacacacccatggaaacaaatgttcc ctcagcggttcccagaacccagtcacggatgtgatcacaagctgagctgg cagcagagagagcactggagagcttcctcgctttgatgattgcagcacca cgctgctggacagtggcaatgaactccccatttagccattcatcatcttg aacaagttcacgaacaggcttctctccactgggagtcttcacagtggcat ggttaacatcaggatactgactggacgagtgattaccccagataatagca ttcttaacgtcagaaacttggacaccaagtctctcagaaatctgaccgag tgccctgttgtggtctaggcgggtcaaacaactgatgttcttctcaggga tagatggagcaaactccttcaggatgagagcattggtgtttgctgggttg gcaacaaccaaaaccttgcaattgggggctgcatgagcttcaagagcana tgcttgagctttgtanattgaaacatttttcgtcataacatccttccttt ccattcctttcctncctg
Download
page-top