Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551862
Length 565 bp
Fasta Format > rwhhg19l08
aagagcagtatgaggaactacacaacaaagaatatgaaaagtgaaagtga cagagcgactaacagagcaaactgcacatcactcagcagtttcagcgact caaaatggaaaggataaatatatgaaatgacattaagaaacttagcactg actaccatacaacaagaccagtgtagagcgtcgcttcaatgtctaatgct tcttcccacttcccaggagcaacatgatcccgtcttgacgaacttgagag gcggcagaccaagagaatgccatgctcttaggcagatgccttgtcgaact tgaggggcttcaccacctcccaggtgaagtcggcatcatcacggccaaag tgaccgtaagcagcggtcttgatgaacctgtttccacctttcttcaagtc caggttgatgctgatcatcccgggcctgaagtcaaagttctccttcacga gcttgaggatctccctgtcggggatcttgccggtgccgtaggagtcgacg aacacagacaaaggctcaggcacaccgatggcgtatgagatctgcacaat gcagcggcgtgcgag
Download
page-top