Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551346
Length 860 bp
Fasta Format > rwhhg17j03
ggaaaaacattctcagttcaacctagggactcgaacagtttacagaaaat ggtgttcagtatgtctgcaaacatgacatggacgcaacatctaagaaaat ccaacaagtaacatgcagcagctcttcagcctaagctgtggcacccttgc ccttcttcttctggagcttcctcatgtagaactccagctccttgccctcc aggatgtacccatcagctctgccacactgtccagggcgagacgaaatgca ggccagcagccttccaccgctgaactgctcctcaatgtgagagtccagtg tacgtccctgctggcgcttctcaagcttcctctggacattgttgctcttc tttgcttcctctgtggcagcagcagcaacctcagactcttgtccctcagc agcatccttcttggcagctgcagcagctttcttcttcctaccgatttcca ctccataatgagtcaggtaccactgcttgaaaggggcagcatcaacttgc acaatggcattcttgacaagggtctgagtcctcacaagctcattgtttga cgaattgtaaaccacatccaggagacgggtcttgcgggtcacagcctcac taccccatgagaagttaccagtgtccagacggagagccctccacttcacg ttacctccgcgaacacggaccctcctcactgtcttgttgctcgaaagctt agtgttggctggctggcggccgagctcatactttcgcttcttcctccacg ccttctgcttcccaccggtggcccggcgcttgtgcatggagtcacgcnag atacccatggtggcgtcggtggcttggctccgctgctgcttcncctccta tgcncgcgnc
Download
page-top