Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551323
Length 884 bp
Fasta Format > rwhhg17h10
agtcttacagggagatagctgattattgtgaatacagagtggaagtgtcc ttgcattacatgtcttgcacactagatgctacatagtagatacataaaac atgagcccacttggaatgctagatagatataaatactttttagatccatg ctaatggttctttcaacaaaagcatttcacttctgctaggttgcaagtaa cttagtaatctgatacaatatatatggcttcaataactggggccaattcc tttactgtagctaacttgtggggccatctttatctcatccatcttccagc ctgcctcagggctgtagtaatcccacatcggtgatggtagcagagggcca gaggggctgctgtatgaattatccttcccgtcatgaaagttgaccccaga gggtgcctcaatctccatccatatctgatccatgaggtatccatccatgt cagcaggcgtgcccttcaatatgcttgtgatgcagctactgccaccatga agctcctgctcgccaattcccatgatcgatggcgtctgtggctgaatgga ttggtatgtcactgaggatgaagatgatgagggtgacatgttcctcttcc tctcctgtgctttcttcctcatatgtgttctccagtagttcttgatctca ttgtcggtacgccctggcagcttccgtgctatcctggaccacctgtttcc ccaccgagcatggagctcgaggatgaggcgttcttcatggggagtcatgc gcccacgctttaggccagggtggaggtagttaacccaccggaggcgacag ctctttcctgtgcgggttgangcctaattttggggatcccccacccctca aacctgatactttggcaatgaaatccccaacggc
Download
page-top