Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551213
Length 263 bp
Fasta Format > rwhhg16p22
atttctgacgtccacacacctttcttttcttgtttcaatgatgacagata tgtggatgactcggtaaaaaggacaatgtaacaagataacatgaattttt gttcacccatctaatagggagaacgattcaagtcgagcacaggcaagtca agagggatactcacgaggatagaaaaactaccaaaataggccattgccgc ctcaaactacttgacctcctcttttcatattagaggattttgaatggcca catcgaccattgc
Download
page-top