Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551208
Length 928 bp
Fasta Format > rwhhg16p12
attgctgatatatgttcagtagcaaacattatcattattggcttgcaagc tcaagtcagggggaggaaacacagtagcagctgctccaccacaaaattac tagcatagtacacataataaacacaggagagaaaaaaaggagtctcttca tcttcgctgtcttactccacgccgaaaggagccacgtcgagatcttgctt aggcagacttcacggtggcggcgttgatgatgtcgatgaactcaggcttc aaggaagctccaccaacgaggaaaccatcgacgtcgggctgcgcggccaa ctccttgcagcttgcgccagttacagatcctccatagatgatccgcgtgg attcagcaacctcggggctcacattggtcttgagccagtccctcagattg gcatggacttcctgtgcctgagccggtgatgcaactttaccggtgccaat ggcccacactggttcataggcgacgaccacgttggtccagtccttgatct tgtcagcaattgcttttgtctgttcagcgacaaccgccatggttgatcca gcttctcgctgctcaagagtctcaccaacacatgcaatgaccttcaagcc ctgagcgagtgcatatgcaaccttctctccaacaaactcgcttgattctc ccatcaagctcctcctttcagagtgtccaaggatgacccagggaacgccg aggttgacaagcatctcagcactgacttcaccggtgaaagcaccgccctt cttcacccagcagttctgagcagcaacttggatctctgggcgcagcttac ccttgacggtgggaaggaagacatagggcgggctaacgacaacctcgaca acatccgtaaaggcgatctgtccagcgttcanagtattgacgatgctctc tacctgttcgacagttccattgcatttc
Download
page-top