Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551203
Length 805 bp
Fasta Format > rwhhg16p06
tagttttacatcttcatttgcaacttctattggagttgcttttttacatc tccaatatacatcttctgttagagttgacacctttggagatgcaaaagac acttttcgaagatgtaaatttttacatctccaaatttgcatcttctgtcg gagatgctcttacagagaaagtagcagcagcagcggcacggcccacctga ccaacgacccgcctgcagttcactgccctttgctccggcaagcctgcctc aggggcatgggcgggtctgagagcccgccgccgacgatctgatcaaagaa gaacttgttcgccgcctcggtgaagtggacgccgtcccagctcactctcc tggccgggtcgtcgcaggattttcccagcaccacccacttccccttcacc agcaccttcccgccacaaccaaccttcgggtcgaagttgtacgggccagc gtcgtgcccgcagcaggtgagcagagggtcgtcgaagcctagcttgctgg cttggctgatcagcttgtacttcgcggcgtagacatcgacgtaggtgaac gcggcgtcagggtaggttttccgaagatgagccactgtttccttgagcct ctggttgaagagttgcgcgaccttgttgtaggtgacagagcagccaacat tgtccttgaccgcggcgatgtcgggccggcgaatganggcgtaaggcagg cagccgataggccccgtgctgtggatccanaagttccttccaccgancac atgcacgctctggattattgangtgancctctccatgagctcaggaatga acgct
Download
page-top