Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551186
Length 804 bp
Fasta Format > rwhhg16o02
aactgtatgcaacaaacagcagcacggactgactcatggagcaaaagcta ggctgaagataagcacacaaatgtacaggatgtacaggacacatgcacag attacacacacctgggaatcatccacaggctaattgtcaattattattac aaataacactggatggttcaataagttgcggccaactggatatataggac tctggcaaactaaaacacatgtggacatttgcgatgatgagatcaggcat ggttactcgctggcttgacaacggtgacagggcaggcggcattgttcacg acgtaatcgctgacgctgcccaagagcaccctcttgagcttgccaaggcc cctgctcccaatgaccagggagctgatgggcatgtcatggatggcttggc acagcttctcgcggggatctccaaacaggacttttgaaaccacggagacc tccttctgcttagctatagtgttgagcatgtccagcgtttcagcatcagg cttcaccccatatttctttgcagttgaagggtgagagaactccgagaggg ggatcaaaggcgagccggaggcctcccagaggagggtctcgccctgctcg tagtcggggtccttgaggacgtgcaggaggagcaggttgtcgccggagcg gagcaggttgtccgccgcccactgcagcgccgcgcggctcccctccgaga agtccaccgccaggcccacccacctctcnccgtccgcanccatggccgat ctcttctcttctcctcnctcggctcttgggtggtggtgnangncaccnct nntt
Download
page-top