Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551172
Length 662 bp
Fasta Format > rwhhg16n04
gtggtacacaggacatacataaattggcatgcgtacgtgcatgcagggtt caagtacaaacataacagacttagtctatagctgcccagaagatgcataa gacttcttattaccagcaaatcatctaccatgtcttaagcacaacttgga gttagctgaggtcctcgccattgccattgtcagtctgatcgccatcatcg tcgtcagtctgatcctcctttttcttgtcaccgtcaccgtttccgtcagc ctcctcctcctactcctcatcctcattgtcagcccctcttcatcctcctc ctcctcatcctcattgtcagcctcctcttcatccccctcctcctcctcct cttcattgtcagcctcctccttgtcagtctcctcctcggggtctatcgag aaggggctgtctgtcgagaaagtgctcaccatgctactagtgtcttcatc ctccaccacgttatctgtgatgttcagtgttacaatccactcatcgtccc aagaggtaggttgcacgttctcaagccgccggttttccagctcttcagcg gtcagcacacgtttcttgctctttttcttgccttgattgtttccaccgga tgaaccgccactgtccattttgttcttcttctcttggcttttttccctct tcaactttagtg
Download
page-top