Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551131
Length 407 bp
Fasta Format > rwhhg16k07
tgaatcctgacactgatatgtttcctgccaaacagttggcctgcagcaca aacacactaaaaaccgtatgaaacaggcaaaacactactacaagatgtct accctgcgctgagttaccttttgacagtgtattcgatgaggttggtaaaa cggctcatccgattcagctaatcaagcacggtgtgtatagtttctcggca ctagtagtagtagcaggaggcgtcaacgtatcatcgggttcattgtgcca tcagtttgccggcttcatgaaaggccaggccgaggagcacaagtcctggg cggtgttcccatcgccgtccttgatctggagatcggcgtggtgcttgacg agcagttcggcgatgtcctccctctcgcagaggacggcgtagtggagcgc ggtctgc
Download
page-top