Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551120
Length 861 bp
Fasta Format > rwhhg16j11
aatatgagcgtgtcatgccatcggtagaaacatcagtatttacatcccac aatcctagagtagaacagaatagatatgcgcttctaactaggaggagcac cccctcttcagaaatgcatctcctcttgcggatcattcatactacaacaa atctgtcgaccacatcaaagggcagccacagggcagacacaaaaaggaaa aatgaggtgccaagaaacacagacgagccatccctgttactctttacgcc gatgtcgaagctaaccgccctgtagctcgcatttcatccagagtcgtcgc tagccagtccaagccttcgtacaggccatcgcctttaagagcacatgtgc cttggatgtgccagatgcggttgttcaggtcatacagaccaagaccctca catacttccatcggggtcattgctcccctcatgtcttgcttgttagcaaa caccaataatacactgttgagcataaatgggtcattgattatggcctgaa attcagccctggctcttccaattctatccctgtcgagggaatcgaccaca tagatcagagcatccgtgttgttgaagtagtgcctccacaagggcctcaa tttctcctggccgcccacatcccacacagtgaacactacattcttgtact gaaccttctcaacattgaaaccaatggtggggacggtggagagtacttcg ccaatgtgtagcttgtagagtatggtggttttaccggctgcatccaaccc aagcatcaccacccgcatctccttgttgccaaagaaggcatcgaagagct tgcgaaaggcctgggcccatctccctccctccttgggatcaggagaatct ggccggctggt
Download
page-top