Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ550828
Length 466 bp
Fasta Format > rwhhg15g06
gcattctcgtctanctttgccctgtgtgcaagtcctcttgtccaagcaaa gattgaagcaatgctgtttgtgctggtttcaccacctttctggtgaacac ggaaatggcgggtaactgtgccatgggcagcttcagcttcgatggtttta ccatcagggcacatcaatactgacgtcatcaagcccaaagagccaaaacc ttgagctaagaaatcactctgcacatctccgtcatagttcttgcaagccc aaacatagcctccttcgctcttaagtgcataggcaaccatgtcatcgatg agacgatgttcataccatattccagcagcctcatatttggatttccagcc agcttcatagatctcctggaaaatgtccttgaacctgccatcatatttct taaggattgtgttttttgtgctaaggtacaatggccatttcttctcataa ncgattgccatanaag
Download
page-top