Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ550824
Length 853 bp
Fasta Format > rwhhg15f22
agcatcgactggagaaaattctcaatcaactgagactagcaaaattggtt tcaaactcgacttgtttaaaaaaaacgctggcagccagaactcttttcta gtaagtagcaggatttttcctgctctcctaaaaaaagggcaaactaccaa gcaaattaaacgagcaaactatgcatctccattcaaatgtagaagctgct ggttagacatgacacaatcatcagatgtgaataatggttctatatgtcct ttattgtgagccccacttacataacatcagcatctacagaatcgcttgca tgtttgacaataatatgcgatggtgcagtaaaagctcgttctgttcacaa tgaaagcatgacaggtaatggcgacataaccaaaatgacttgaatcgatg agtaatgactattcaagcattgaagtggaagaggtctttcacagtcttga tttgagctcagcagcaacagcgtcaatgaactcttcagtgttcaggtaat cgcttcttgtaacttttgaggatccatggacaaggagtgcaaggtccttg gtcatcttcccagactccacagttccgacgcacgcttcctcaagtttctg tgcaaattcaagaagtctagcattctcgtctagctttgccctgtgtgcaa gtcctcttgtccaagcaaagattgaagcaatgctgtttgtgctggtttca ccacctttctggtgaacacggaaatggcgggtaactgtgccatgggcagc ttcagcttcgatggttttaccatcagggcacatcaatactgacgtcatca agcccaaagagccaaaaccttgagctaagaaatcactctgcacatctccg tca
Download
page-top