Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ550628
Length 859 bp
Fasta Format > rwhhg14j10
cttttgtgcgcccaagatccatcacctgnttctgatgactgaaggcaccc aggcactattaccatcacaaacacagtaggtacataaatttgcacgcaca gaatatgtaaaactaggttcggtgaaccgaaatgtttaaagaaactctgc ataagcaacatccaacagaacaaacacgatatgatatttaaggtatctca tacgcggcacacagatattgcacagaaaacagttctgaacttcagatgct ccaaaatcaggctaacccttcatgataccagaaagctaaagcttcatgtc agaccttcacttcttggccttggccttctttggtgccgctgctgctggag ctggagctgcagccgctggtgctggtgcatgatctctggggccctgagcc aatctctcctccctcctggcatgcttcctctccctgcttgccttgctctt ggcgcgcttggcctcaaactgatcagagagggtcttctctcttgccttct cagccttggacttgtggatactctccatgaggaccctcttgttcttgaac atgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgat cttcttggcctcacggtacttgcgcagaaggcgcctcaggacgcgcatcc tccgcatccacaggatcttggtggggagcctagcctccctggtaccccta cgcttaccatatccagagtgacggcccttctgcttggcctcatgtgccct ccttgcacgagacctggagtggatcttctgaggcttcctgatgatgaaac catcctttaccagcttccgggatgttctgccgggagttggccatggnaga tctcgttga
Download
page-top