Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ550286
Length 855 bp
Fasta Format > rwhhg13c19
accgaaatgtttaaagaaactctgcataagcaacatccaacagaacaaac acgatatgatatttaaggtatctcatacgcggcacacagatattgcacag aaaacagttctgaacttcagatgctccaaaatcaggctaacccttcatga taccagaaagctaaagcttcatgtcagaccttcacttcttggccttggcc ttctttggtgccgctgctgctggagctggagctgcagccgctggtgctgg tgcatgatctctggggccctgagccaatctctcctccctcctggcatgct tcctctccctgcttgccttgctcttggcgcgcttggcctcaaactgatca gagagggtcttctctcttgccttctcagccttggacttgtggatactctc catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca tgtcatggtacatgtgcttgtcgatcttcttggcctcacggtacttgcgc agaaggcgcctcaggacgcgcatcctccgcatccacaggatcttggtggg gagcctagcctccctggtacccctacgcttaccatatccagagtgacggc ccttctgcttggcctcatgtgccctccttgcacgagacctggagtggatc ttctgaggcttcctgatgatgaaaccatcctttaccagcttccggatgtt ctgccgggagttggccatggagatctcgttgacctcattggggtcgagcc anaccttgcccttgccgcacttgaggacgctcgangccangcgcttctgc ancttcancgacaccatcttcnccgccgctctcctcctcccttacctgcc gtctg
Download
page-top