Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ550284
Length 862 bp
Fasta Format > rwhhg13c17
aggtagaacaacacataatagaatctggatagctttagatcacaaccaaa acaggaaaaacattctcagttcaacctaggactcgaacagtttacagaaa atggtgttcagtatgtctgcaaacatgacatggacgcaacatctaagaaa atccaacaagtaacatgcagcagctcttcagcctaagctgtggcaccctt gcccttcttcttctggagcttcctcatgtagaactccagctccttgccct ccaggatgtacccatcagctctgccacactgtccagggcgagacgaaatg caggccagcagccttccaccgctgaactgctcctcaatgtgagagtccag tgtacgtccctgctggcgcttctcaagcttcctctggacattgttgctct tctttgcttcctctgtggcagcagcagcaacctcagactcttgtccctca gcagcatccttcttggcagctgcagcagctttcttcttcctaccgatttc cactccataatgagtcaggtaccactgcttgaaaggggcagcatcaactt gcacaatggcattcttgacaagggtctgagtcctcacaagctcattgttt gacgaattgtaaaccacatccaggagacgggtcttgcgggtcacagcctc actaccccatgagaagttaccagtgtccagacggagagccctccacttca cgttacctccgcgaacacggaccctcctcactgtcttgttgctcgaaagc ttagtgttggctggctggcggccgagctcatactttcgcttcttcctcca cgccttctgcttcccaccggtggcccggcgcttgtgcatggagtcacgcg agatacccatgg
Download
page-top