Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ549922
Length 610 bp
Fasta Format > rwhhg11j22
tttcgagactcaggggaagaaagagcaggtatgaggaactacacaacaaa gaatatgaaaagtgaaagtgacagagcgactaacagagcaaactgcacat cactcagcagtttcagcgactcaaaatggaaaggataaatatatgaaatg acattaagaaacttagcactgactaccatacaacaagaccagtgtagagc gtcgcttcaatgtctaatgcttcttcccacttcccaggagcaacatgatc ccgtcttgacgaacttgagaggcggcagaccaagagaatgccatgctctt aggcagatgccttgtcgaacttgaggggcttcaccacctcccaggtgaag tcggcatcatcacggccaaagtgaccgtaagcagcggtcttgatgaacct gtttccacctttcttcaagtccaggttgatgctgatcatcccgggcctga agtcaaagttctccttcacgagcttgaggatctccctgtcggggatcttg ccggtgccgtaggagtcgacgaacacagacaaaggctcaggcacaccgat ggcgtatgagatctgcacaatgcagcggcgtgcgaggccgctggcgatga tgctcttggc
Download
page-top