Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ549841
Length 841 bp
Fasta Format > rwhhg11e08
ttaaagaaactctgcataagcaacatccaacagaacaaacacgatatgat atttaaggtatctcatacgcggcacacagatattgcacagaaaacagttc tgaacttcagatgctccaaaatcaggctaacccttcatgataccagaaag ctaaagcttcatgtcagaccttcacttcttggccttggccttctttggtg ccgctgctgctggagctggagctgcagccgctggtgctggtgcatgatct ctggggccctgagccaatctctcctccctcctggcatgcttcctctccct gcttgccttgctcttggcgcgcttggcctcaaactgatcagagagggtct tctctcttgccttctcagccttggacttgtggatactctccatgaggacc ctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta catgtgcttgtcgatcttcttggcctcacggtacttgcgcagaaggcgcc tcaggacgcgcatcctccgcatccacaggatcttggtggggagcctagcc tccctggtacccctacgcttaccatatccagagtgacggcccttctgctt ggcctcatgtgccctccttgcacgagacctggagtggatcttctgaggct tcctgatgatgaaaccatcctttaccagcttccggatgttctgccgggag ttggccatggagatctcgttgacctcattggggtcgagccagaccttgcc cttgccgcacttgaggacgctcgaggccaggcgcttctgcagcttcancg acaccatcttcnccgccgctctcctcctcccttacctgccg
Download
page-top