Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ553956
Length 532 bp
Fasta Format > rwhhg9c15
ggggcctcgagggctcgaatacatcagcttgaatacaaacgagtcagcgg aagcaacaatatctgagtacagacataagttaaacaagtttgccttaaga aggctagcacaaaagcatctacgatcgaaaaggcaaggcctcctgcctgg gagcctcctaactactcctggtcatcggcggtcttcgtcacgtggtagta gacgccctcggtgtagtagcagtagtcaaaggtctcatctggctcctgga ctccgtcatcgagaggaggtcggtggtgagctcgtacgaggccgggatgg acgaggtgatgcggatcgacgtcgaggccgcggcgatgtacaagatgaag atggtggcgatggcgagtgtacgggccttccccgctcgattcggtcctcg ggatggacgaagtggaccgtggcagtccttctgggcgtcttctcgcggcg cggggagcacggtggtcgcggccatggcgacggcagcagcggtttcacgc gaggagaaganananancnagggaaaggggna
Download
page-top