Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ294529
Length 611 bp
Fasta Format > rwhsl13e09
ctgctgcgcattactaatactcaaacaagtcaagngttgcatcaagcagc agcatccttagcgaccgnaaaacatcatctaagtgcttaaccaaaacttc cacatgcaaaaatcttcaaactcttacacgctaaaacacacaggccagta gagtagggacccgctcacatgaagaggttgggcctcgtcgccttgtaggt ggtcttgagcttgcgggtgggtgggcgaaccttctggtacaccagcggga acttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagc ttgaagtccaccgtcgcagtcttgatgatctggatgcagggggcacgcac gcggtgccgcgacgccatctccgtgtacatctgctccaccccgccgttga gggtcgtgtcacggtactccttgtacatgttgtggtaaccggtcctgctc tggtacctcagccagatgccgtagttcttgattgtggtggggttcttctc aaagatctcgttgatggcgagcatctggccgttggccttcttcaccttct tgagcttcctcaggaagtaccaggaacttggacttggcgcgggacctcat tggtggcccag
Download
page-top