Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ553358
Length 853 bp
Fasta Format > rwhhg6j01
ctttcagactcaggaagaaagagcattatgagggaactacacaacaaaga atatgataagtgaaagtgacagagcgactaacagagcaaactgcacatag ctcagcagtttcagcgactcaaaatggaaaggataaatatatgaaatgac aataagaaacttagcactgactaccatacaacaagaccagtgtagagcgt cgcttcaatatctaatgcttcttctcacttcccaggagcaacatgatccc gtcttgacgaacttgagaggcggcagaccaagagaacgccatgctcttag gcagatgccttgtcgaacttgaggggcttcaccacctcccaggtgaagtc ggcatcatcgcggccaaagtgaccgtaagcagcggtcttgatgaacctgt ttccacctttcttcaagtccaggttgatgctgatcatcccgggcctgaag tcaaagttctccttcacgagcttgaggatctccctgtcggggatcttgcc ggtgccgtaggagtcgacgaacacagacaaaggctcaggcacaccgatgg cgtatgagatctgcacaatgcagcggcgtgcgaggccgctggcgatgatg ctcttggcggcctgcctggcaatgtaggcgccactgcggtcgaccttggt tgggtccttgccagagaaggcaccgccgccgtgggctccccagccaccat aggtgtcgatgatgatcttgcggccggtganaccggcgtcaccgtgaggg ccgccgatgacnaancggccanacnggttcnngtggaanatggngttctc ntcnangnacttcncnnnnnatcnncnnnttnntnacntnntccttnnng nnc
Download
page-top