Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ553304
Length 850 bp
Fasta Format > rwhhg6f06
ctgcaaaatgattccatgtgcacatagtacaacagatattatggtctgac tggagtgtcaataccgaaatagagtacacgataaaatcaaactcgtacag gcaagtcttttgttcaacatgtttggagagtttcataactgtaggaagaa tatgatccatctctcgaccctcaccaggtgatgctcttccactgggtgaa cactggaaggattttgatccataactcaacctccaccaggtgaggcactt ccactgggtgcgcggtggttgccattgtcttcaccatccctggggctcgg gctacgaccatttgcagctgggctcatgttattagggctgtcagccttca ttgggctcctgctgttttcccttggtgcagggctcctgctgccaggaggg gtggggctccgggccctccccttgacaggtgaagcgctcctcctagggct gcggctgtcacgggggctcctcatagggctgcgactgccacgggggctct tcatagggctgcgactgtctcgggggctcctccttgggctgcgactgtca cgggggctcctccttgggctgcgactgtcacggggactccttgatcgcct ttcatccctccttggggaaacagagcggctgtagctcctactgcggctcc tgctgtagctcctatcacgcacccttccgcggcgaggagatggagatctg gagtaactctttccacgcttgaggttcttanggctgttctggcaatctct ttctatgtggccactatctccacaacnatancacctatttttccantcnc canctttgcantcacnancccaatgcccatcaatcccacagntaaaacaa
Download
page-top