Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ553192
Length 856 bp
Fasta Format > rwhhg5n21
ggaccacagagggaatagttcaatatacagggncaggcaagaagtaattc aaactgctaaacaccacaaggccaacacaaagtattccccattgctacac aaagtgggattaaagcttgacagggcttgatgtcagaccaacactagcag ggacgccaaagcttttatttctgtaaggagggctcctacgaatggaggga tttggctttggagaacagcttcgcgcgcttgaggagtcccgagggtcact cgaccaccatgctctcggcctccttcttgatggagtggaagagcaccgac gaaaggtagcgctctccgaagcttgggaatacaacaacaaagagtttccc tgcattttcaggcctctgagcaaccttgattgcagctgctgcagcagcac cagaagagattccaaccagcaatccttctttcaatgccagagactttgcc atctcaatggactcatcacttgaaacctgtatggtttcatcaatgatgtc aacatccaagacaccagggataaaaccagctccaattccttggatcttgt gtggtccaggctttccaccatttaagacagcactctcggtaggctccaca ccgtagagcttgatgttaggattttgctctttgaggtattttccagatcc agtaatggtaccacctgtcccgatgccagaaacaaggccatcgatctttc ctcctgtgcctttccagatttcaggcccagttgtctcatagtgaatcttt gggttggcagcattctcgaactgctgaaggatgtatganttangtgtctt tgctgccanctcttccgccttttggacagctcctttcattcccaanagtg ggtcgg
Download
page-top