Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ552997
Length 876 bp
Fasta Format > rwhhg4n11
gcacagatagcagcagataagctctgtttattcaacaatacattgtcaac ttggaaatatccagcagaatttaagcgaggaccatgacatacaggcacat tgcctaggcatgatgcaagagctagactgcgtagcacaatgcagctgaat gcacattattgacagaccaatatccagttcacgaccagtagccaaaagcc ccagcgactactaggcatgatgcaagaggaaggttgcatatgcatagcac aatgcagctcactgcacattattgacactctcatatccagttcaccctct aatggttgaaagccctagcgactactactacgcatcgacagttcagagct caagttggacgaccgacttctgattgacacctcaacacgacacacgacca agctggaaaacttgtgtgcacgaacagtgcagactcacaaccagtaagta acagggttaaaatgtcctgtgagaaatagctaacgacaccacaaagaaac gaaaggaactatgatgtcaagaactaaaagaccacggctagaccaataac aggcacctagcaatgtacaccgccgtgtgcctgaaacagtaacaggacgt ttgccctgagttaaccacactagtgtcagcataacaacgtcaatcagaac acccagatgtcttgtctcacacatgatccactaatgttcccatataccac aggaggcccacgataagacctgacaggtgatgagatggtatttacaagag ttgtcttcttattactcagagaaagtgaatgcatgagagcactatcctat cattggcaatatatggcctggtctatctgaggggggaattggtttttatc tcagtcccaagctccctgctcaatcc
Download
page-top