Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ552975
Length 793 bp
Fasta Format > rwhhg4l21
acgtgcgcgctagagcatttagcatgtttcacatgcctcagtggagcaaa attttattacagccaacaagatccctagtgttcctcaagactagctaata actgggttgggctgctggggcagcttcacttcttcacctcctcgtactcg gcctctggggcctggtcgcctccgccctgcgagcctccttcctgggaacc accgccagccgcgccgcctccagccgcaccaccaccagacatgtgctccc cgatctttgagaccgccttgttggccacttccatcttgctctttatcttc tcgatgtcgtcagaggccatctccgcgcggagatcagcaaccgccgtctc gatctcggtggcgacctccgcggggatcttgtccctgtactctcccaggc tcttctcgatgctgtagatggtggtgtctgcggtgtttctgatgtcaatg agggccttgcgctcctggtccttctgtgagtgcaactcagcctcccgcac catcttctcgatctcggactcagaaagcccaccggacgatcggatggtga tctgctgctcctttgcggtggccttgtcctttgcagagaccgtcacaatt ccattggcgtcaatatcaaacgtgacctcaatctgtggcagtcctcttgg ggctggtgggatgcccacaagatcaaactcgccaagaagtttgttgtctg ttgccatctcacgttcaccttgcaggacacggatacccacttgcgtctgg ttgtcagcagcagttgagaacanctggctttttctttgtgggg
Download
page-top