Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ552862
Length 913 bp
Fasta Format > rwhhg4d03
tctggcattacaacatatagcggcaagaaaatactacagacaaatgatac taggtccactaggtataatgggaaacacggggatacagtcgtctagacac gcggcagttgcatcagaccattttgtggctcaaaaagtttctaatcgtca ccaaatgtggtcttcttccctgcgctagctgtgccagcactctgtctgct ctgaaagcctcggccgcctcctctgccgccatcacggccaccagaccggc caaacctgccgccaccatcacggccaccagaccggccaaacctgccgccg ccatcacggccaccagaccggccaaacctgccaccaccagagcggccacc atctctgccaccagatcgaccaccaacgccaccaaattgacccttaggct tagcttcagcaacatacaagttgcagccacctaggtcagatccactaagc tcaagtgctttcgaaaaggaactctcatcagtaaaatccatgtaagctat ccctttgcttgcaccattctcataatccatcggaactgagacacgtgtga tttctccacatttagagaagtgttcttgaagagagctccgaatagcatcc tcctgttgagatgaatcaaaacccttgacaaatactgagaggctgggacc tccacttggttttccaaacgatccaccatccctggtgcgaggagttgcac ctctttcagcagccatgtcaagtctcaccggacggcccattagatctcca ccattcagtgaatcaagcgctttctgagcatcttcagccgtagcaaactc aacatgaccaaatcccttggggatgggccatcttcatgggtagccaggcg aacatcaacgacctctccaatttgtgcaaaaaattgcttcacctttgatc atactccaatatt
Download
page-top