Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ552836
Length 791 bp
Fasta Format > rwhhg4b14
ctcgcttcattgaatggagcaggggctgtgatgctatataattaaaagga acttttatcacccagcaacatgcatatatatatatatcctaaatgaaact ttgttattactatctactgctacaaagaaatcaacatcagagcacttctc cctgtataatggtgaacacgcactttaagaaaaagaaaatgtagagcaca gcttttacattcgatgtacttgagggaagccatgaaagagacggctggat acagaagcacatcgttcttctccagggagctcatgagctctggccctcct gcagctgttgctgctgctgctgctgctgcaagttgacgagcttgtggtag gcaccattcttgttttcgatgaggtgctggtgatccccctgctcgatgat cttgccgtcctggatcaccgagatgacgtcggcgttcttgatcgttgaca gccggtgcgccaccatcacagtggtccggttcttcatcaccctgtccaga gcctgctgcaccacgcgctccgactccatgtccagcgcgctcgttgcctc gtccaggagcaggatggccgggtccttgacgatggcgcgtgcgatggcga tgcgctgcttctgcccacccgacagctgcacgccgcgctccccgaccttg gtctggtacccctccggcagtgagctgatgaaggtgtgcgcgttcgccag cttcgccgcctcgatgacctcggcctccgtcgcgccgtccttgccgtaga ggatgttttcgtagatcgncgtcgcgaacagcgccggctct
Download
page-top