Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ552629
Length 854 bp
Fasta Format > rwhhg3c20
cttacataacatcagcatctacagaatcgcttgcatgtttgacaataata tgcgatggtgcagtaaaagctcgttctgttcacaatgaaagcatgacagg taatggcgacataaccaaaatgacttgaatcgatgagtaatgactattca agcattgaagtggaagaggtctttcacagtcttgatttgagctcagcagc aacagcgtcaatgaactcttcagtgttcaggtaatcgcttcttgtaactt ttgaggatccatggacaaggagtgcaaggtccttggtcatcttcccagac tccacagttccgacgcacgcttcctcaagtttctgtgcaaattcaagaag tctagcattctcgtctagctttgccctgtgtgcaagtcctcttgtccaag caaagattgaagcaatgctgtttgtgctggtttcaccacctttctggtga acacggaaatggcgggtaactgtgccatgggcagcttcagcttcgatggt tttaccatcagggcacatcaatactgacgtcatcaagcccaaagagccaa aaccttgagctaagaaatcactctgcacatctccgtcatagttcttgcaa gcccaaacatagcctccttcgctcttaagtgcataggcaaccatgtcatc gatgagacgatgttcataccatattccagcagcctcatatttggatttcc agccagcttcatagatctcctggaaaatgtccttgaacctgccatcatat ttcttaaggattgtgttttttgtgctaaggtacaatggccatttcttctc ataagcgattgccatagaagcttcancaaaacctcgaattgactcatctg tgtt
Download
page-top