Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ552113
Length 830 bp
Fasta Format > rwhhg1o20
gaggagcagctgcccttcgaatgtggatttacgccaggcatgagtaggcc aacgccttctcctctgacagctcctgggcggtcgcatccatcttcttcct cgagaactcatcgatcgggagcccttgaacaattgtccattcaccaccac tgcacgttactgggaaggagtagataagaccagcaggcacaccgtatgaa ccatcagagtacacacccatggaaacaaatgttccctcagcggttcccag aacccagtcacggatgtgatcacaagctgagctggcagcagagagagcac tggagagcttcctcgctttgatgattgcagcaccacgctgctggacagtg gcaatgaactccccatttagccattcatcatcttgaacaagttcacgaac aggcttctctccactgggagtcttcacagtggcatggttaacatcaggat actgactggacgagtgattaccccagataatagcattcttaacgtcagaa acttggacaccaagtctctcagaaatctgaccgagtgccctgttgtggtc taggcgggtcaaacaactgatgttcttctcagggatagatggagcaaact ccttcaggatgagagcattggtgtttgctgggttggcaacaaccaaaacc ttgcaattgggggctgcatgagcttcaagagcagatgcttgagctttgta gattgaaacatttttcgtcataacatccttcctttccattccttccttcc tggggaatccaccaaccataaccgcaacattcacaccagtgcaagcctca aacaacatcagttgttgcaacaactccctt
Download
page-top