Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ552027
Length 876 bp
Fasta Format > rwhhg1h23
ttcgttcattcaatttttacggttatgtttcgcccagggagcatcaacaa gcgaatgctcaggctttgggtagtccgttctctgcttttgtcacggaagc acgtggaggccatggcgcgccagccattaccgcttcgatttcccaggtct cccgggggcagtttgtcaggttcttgcatccttgtgccgtcacatacaga tcactttcaatacgaacaccaccaaaacttttgtacttctcaatctcttc ccagttgaagaattttgaggaaattggatcatccctggcaggcctcagca aagcatcgatgaaataacagcctggctcaaccgtaataaccatgccttct ttaagttctcttatggtccgcaaggagctcagtcctggctcctttggtct ctctaagccctcagggtagcctccgggatcatgggtgtcaattccaagca agtgcccaagaccatgaggcatgaaaacagcacccaaccttcgagccatc atatcagcaatatcaccatggataatcttttcattcttgagagattcaag tattgtctgctcggccagcttgtgcatatcaacccattttaatccaggct gcatgtgtgatatgacagcattatgagccttaaggacagcattgtatact attgcctggttgctgttgaacttcccatttatggggtatgaacatgtgat gtcagagccatagaaattatattcagctcccatgtccattagagccatgt ctccatcattcagcgtccggtcatttggagcagccgtatgtccataatga agaatagaactgttctctccggtagcgcatatgcatgtggtaggagcaat gtcnacaggctccataccctataaaa
Download
page-top