Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ551990
Length 755 bp
Fasta Format > rwhhg1e18
atgatgcgccaaaaactagtattacacacccaaaaggttcggggccgaat caggtacatatccacaaggaccaaaattggagcaagtttgggggtacata tccgttccgttcacataaacatgcgcggcattattgctcaatcctaagag cttcaaccagagttcattccggaggttaaacacacccattttcacaaaaa ctcgcgaagataccgtctagtagggctccaccggtgcgcggaacttgagg ccagcatacactgcagcgtcgcccagctcctcctcgatcctcagaagctg gttgtacttggcaagacgctctgaccggcagggagccccggtcttgatct gacccgtggacagaccaacagccaaatcagcaatgaatgtgtcctcggtc tcaccactcctgtggctggtcatgacaccccagccagcatgttttgacat cttcacggcctcgatactctcagtgacggatccaatttggttaaccttca gcagaagagcattgcatgacttctcctggattgccttcgcaactctggtt gggttggtgactanaaggtcatcaccaacaatctgaacttccactccaca ttcttcagtcatcttancatagtgcacccagtcatcctggtcaaatgggt cctcaatcgacacaatggggtactcactcacaaatgacttgtatacgttc ttcangctatctccnnatatcttctgagaaccatcattgttctcctcctt gaant
Download
page-top