Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661556
Length 665 bp
Fasta Format > whhg9i02
ccggttttcattgtttggagaacacacaatacacctcccaccttagcagc gcaatggcgaccaccaccatgtccctctcctcgaccttcgccggcaagtc ggtgaagaacgtggcttcatcagctctctttggtgaggcccgtgtcacta tgcgcaagaccgctgcaaaggccaagccggtttcatcaggtagcccatgg tacggtgccgaccgtgtgctctaccttggcccgctttccggagagccccc gagctacttgaccggcgagttccccggcgactacggatgggacaccgccg ggctctcggccgaccccgagacctttgccaagaaccgggagctcgaggtg atccactgccggtgggccatgctcggtgcgcttggatgtgtcttccccga gcttcttgcacgcaacggcgtcaagttcggcgaggcggtatggttcaagg ccggttcccagatcttcagcgagggtggcctcgactacctgggcaacccc agcctcgtgcacgcacaaagcatccttgctatctgggcatgccaagtcgt gctcatgggcgctgttgaggggtaccgcattgctggcggcccactcggtg aggtagtcnacccactctaccccgggggcancttcnacccactgggcttg gctgacnatccanag
Download
page-top