Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661543
Length 215 bp
Fasta Format > whhg9g21
gatcgccgccgtgcccgagacccgtgaccggacctcgattgaattgttgg cgtgtgttgtgtttgctttacgtctaagttggtgtcaaggtgggaggggt tgatcgtctttgaaggtccggtccgtgaagcccgttcagtgacgggtgct tctgtttcagtttggttcagagtcaggtcctggatgttgtcaagtttgtt tacttaaaaaaaaaa
Download
page-top