Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661311
Length 695 bp
Fasta Format > whhg8f16
cgcctcttccctccctccttcggttcctcggcctcccgatcgagcagtag aagcagcgcaagggcaccgctagcactaaaggaatggcggccgagacgtt cctcttcacgtccgagtctgtgaatgagggccatcccgacaanctctgtg accaggtctccgacgccgtcttggatgcctgcttggcgcangatgccgac agcaaggttgcctgcgagactgtcaccaagaccaacatggtcatggtctt gggcgagatcaccactaaggccaccgtcgactacgagaagatcgtgcgcg acacctgccgcaacatcggcttcatctctgatgatgttggtctcgacgcc gaccgttgcaaggtgctcgtcaacatcgagcagcagtcccctgacattgc ccagggtgttcacggacacttcaccaagcgtcccgaagaggtcggcgccg gtgaccagggcatcatgttcggctatgccaccgacgagacccctgagctg atgcccctcagccacgtgcttgccaccaagctcggagctcgcctcaccga ggtccgcaagaatggcacctgcgcctgggttaggcctgacggaaagaccc angtcactgtcnagtacctaaacnangatggtgccatggtacctgttcnt gtgcacaccgtcctcatctccacccancacnacnanaccgtcncc
Download
page-top