Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ659611
Length 624 bp
Fasta Format > whhg1f22
cgccaccaaatccaatctcgagcccccctctcccgtccgcccgtcccaac ccgatccgatctcccccctcctcctccgtcgccatgggccgcaagttctt cgtcggcggcaactggaaatgcaatggaactgtcgaacaggtagagagca tcgtcaatactctgaacgctggacagatcgcctctacggatgttgtcgag gttgtcgttagcccgccctatgtcttccttcccaccgtcaagggtaagct gcgcccagagatccaagttgctgctcagaactgctgggtgaagaagggcg gtgctttcaccggtgaagtcagtgctgagatgcttgtcaacctcggcgtt ccctgggtcatccttggacactctgaaaggaggagcttgatgggagaatc aagcgagtttgttggagagaaggttgcatatgcactcgctcagggcttga aggtcattgcatgtgttggtgagactcttgagcagcgagaagctggatca accatggcggttgtcgctgaacagacaaaagcaattgctgacaagatcaa ggactggaccaacgtggtcgtcgcctatgaaccantgtgggccattggca ccggtaaagttgcatcaccggctc
Download
page-top