Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658277
Length 667 bp
Fasta Format > whhg14k15
cccctttcctcgatctctctcttctcctcgcgtgaaaccgatgctgccgt cgccatggccgcgaccaccgtgctccccgcgccgcgagaagacgcccaga aggactgccatggtccacttcgtccatcacgaggaccgaatcgagcgggg aaggcccgtacactcgccatcgccaccatcttcatcttgtacatcgccgc ggcctcgacgtcgatccgcatcacctcgtccatcccggcctcgtacgagc tcaccaccgacctcctctcgaccccgtgacgatgctgatgcccctgtgat cgactacgtcaccgacgacccctccttctcgcctgagcaaccaggcaagc cccccctttgatcatcccgatgacggagtccaggagccagatgacacctt tgacgactgctactacaccaagggcgtctgctaccacgtgacggagaccg ccgatgaccaggtgtagttaggaggctcccaggcaggaggccttgccttt tcgatcatagatgcttttgtgctagccttcttaaggcaaacttgtttaac ttatgtctgtactcagatattgttgcttccgctgactcgtttgtattcaa gctgatgtattcgagccctcgaggcccctggcttgtaatataaagcttgt attatttaaaaaaaaaa
Download
page-top