Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658222
Length 690 bp
Fasta Format > whhg14g21
ccgccgccgccgcctcctcgtcctctcggtcccctctccttccttcgagt ttgcttcagccatgggtaaggagaagactcacatcaacatcgtggtcatt ggccacgtcgactctggcaagtcgacgaccactggccacctgatctacaa gcttggaggcattgacaagcgtgtgatcgagaggttcgagaaggaagccg ctgaaatgaacaagaggtctttcaagtacgcctgggtgcttgacaagctc aaggccgagcgtgagagaggtatcaccatcgatattgccctctggaagtt tgagacaaccaagtactactgcaccgtcattgatgcccctggtcaccgtg acttcatcaagaacatgatcaccggtacctcccaggctgactgtgctgtt ctcatcatcgactccaccactggtggttttgaggctggtatctccaagga tggccagacacgtgagcacgccctccttgctttcactcttggagtgaagc agatgatctgctgctgcaacaagatggacgccaccactcccaagtactcg aaggctcgttacgaagaaattgttaaggaggtctcttcgtacctgaagaa ggtcggctacaaccctgacaaggttcccttcgtccccatctctgggttcg agggtgacaacatgattgagaggtccaccaaccttgactg
Download
page-top