Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ657939
Length 691 bp
Fasta Format > whhg13c17
gcggcgcgcgcataggaggcgaagcagcagcggagccaagccaccgacgc caccatgggtatctcgcgtgactccatgcacaagcgccgggccaccggtg ggaagcagaaggcgtggaggaagaagcgaaagtatgagctcggccgccag ccagccaacactaagctttcgagcaacaagacagtgaggagggtccgtgt tcgcggaggtaacgtgaagtggagggctctccgtctggacactggtaact tctcatggggtagtgaggctgtgacccgcaagacccgtctcctggatgtg gtttacaattcgtcaaacaatgagcttgtgaggactcagacccttgtcaa gaatgccattgtgcaagttgatgctgcccctttcaagcagtggtacctga ctcattatggagtggaaatcggtaggaagaagaaagctgctgcagctgcc aagaaggatgctgctgagggacaagagtctgaggttgctgctgctgccac agaggaagcaaagaagagcaacaatgtccagaggaagcttgagaagcgcc agcagggacgtacactggactctcacattgaggagcagttcancggtgga aggctgctggcctgcatttcntctcgccctggacagtgtggcananctga tgggtacatcctggagggcaagganctgganttctacatga
Download
page-top