Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ657878
Length 678 bp
Fasta Format > whhg12o24
accgtcctcatctccacccagcacgacgagaccgtcaccaacgacgagat tgctgcggacctcaaggagcatgtcatcaagccggtgatccccgcaaagt acctcgatgagaacaccatcttccacctgaacccgtctggccgcttcgtc atcggcggcccccatggtgacgccggtctcaccggccgcaagatcatcat cgacacctatggtggctggggagcccacggcggcggtgccttctctggca aggacccaaccaaggtcgaccgcagtggcgcctacattgccaggcaggcc gccaagagcatcatcgccagcggcctcgcacgccgctgcattgtgcagat ctcatacgccatcggtgtgcctgagcctttgtctgtgttcgtcgactcct acggcaccggcaagatccccgacagggagatcctcaagctcgtgaaggag aactttgacttcaggcccgggatgatcagcatcaacctggacttgaagaa aggtggaaacaggttcatcaagaccgctgcttacggtcactttggccgtg atgatgccgacttcacctgggaggtggtgaagcccctcaagttcgacaag gcatctgcctaagagcatggcattctcttggtctgccgcctctcaagttc gtcaagacgggatcatgttgctcctggg
Download
page-top