Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ659765
Length 673 bp
Fasta Format > whhg20c23
cgtccacccctcacccgccgccgtcccgtccgttcggtccgttagggttt cgtcggccatggcgatcctcggggagctcggcaccgagatcctcatcccc gtctgcggggtcgtcggcatcgtcttcgccatcgcgcagtggttcatcgt ctccaaggtcaaggtcacccccggcgccgccgccgccggcggctccaaga acggctacggcgactacctcatcgaggaggaggagggcctcaacgaccac aacgtcgtcgtcaagtgcgccgagatccagaccgccatctcagaaggagc aacatcattccttttcaccatgtaccagtatgttggtatgttcatggtcg tctttgctgcggttatcttcgtcttccttgggtcaattgagggattcagc acaaagggccagccctgcacctacagcacgggcacctgcaagccagctct ctacaccgccctcttcagcactgcatctttcttgcttggagccatcacat ctttggtgtctggtttccttgggatgaanatcgccacatacnccaatgct aggacgaccctggaggcaaggaagggtgttgggaaggcatttatcactgc tttccgctctggtgcantcatgggcttcttgttgtcatcaagtgggcttg tggttctttacatcaccatcaac
Download
page-top