Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ659519
Length 756 bp
Fasta Format > whhg19o06
cgcatcagtacatcaccgcagacgccgagaaagacacgccgcattcgtaa cgcagctcccgtgttgcctagcgcggtgctgattaccgagccgttgggag ctgagagctactcggtgcagctgagtgcccgagtgctcctctgtcctctg tcctctacactcctcccctctcctctcgctcggccgagaaggatagatag acctcacctccccctctacccccaccgtgttcttggggcagacgcgccga gatggagcatatcgcgaggttcttcttcggggtctcaggcaatgttatcg ctctgttcctcttcctgtcgccggtcatcaccttctggaggatcatcaag aggaagtcgacggaggacttctccggcgtgccatacaacatgacgctgct caactgcctcctatccgcatggtacgggctgccgttcgtgtccccgaaca acatcctggtgacgacgatcaacggcgcggggtcggtgatcgaggccatc tacgtggtcatcttcctcatcttcgcggagcgcagggccaaggtccggat gctgggcctgctcancgtggtcaccgccatcttcgccacggtggtgctgg tgtcgctgctggcgctgcacggcaaggcccgcaccgtcttctgcggcctc nccgccaccgtcttctccatctgcatgtacncctcnccgctctccatcat gangttggtgatcaanaccaanancgtggagtacatgccgttcctgctgt ccctgt
Download
page-top