Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ659474
Length 604 bp
Fasta Format > whhg19l08
ttgtgcagatctcatacgccatcggtgtgcctgagcctttgtctgtgttc gtcgactcctacggcaccggcaagatccccgacagggagatcctcaagct cgtgaaggagaactttgacttcaggcccgggatgatcagcatcaacctgg acttgaagaaaggtggaaacaggttcatcaagaccgctgcttacggtcac tttggccgtgatgatgccgacttcacctgggaggtggtgaagcccctcaa gttcgacaaggcatctgcctaagagcatggcattctcttggtctgccgcc tctcaagttcgtcaagacgggatcatgttgctcctgggaagtgggaagaa gcattagacattgaagcgacgctctacactggtcttgttgtatggtagtc agtgctaagtttcttaatgtcatttcatatatttatcctttccattttga gtcgctgaaactgctgagtgatgtgcagtttgctctgttagtcgctctgt cactttcacttttcatattctttgttgtgtagttcctcatactgctcttt cttcctgagtctcggaaagaataataaagagccatgtgtaattcaaaaaa aaaa
Download
page-top