Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ659415
Length 825 bp
Fasta Format > whhg19h05
gagagcggcggcgaagatggtgtcgctgaagctgcagaagcgcctggcct cgagcgtcctcaagtgcggcaagggcaaggtctggctcgaccccaatgag gtcaacgagatctccatggccaactcccggcagaacatccggaagctggt aaaggatggtttcatcatcaggaagcctcagaagatccactccaggtctc gtgcaaggagggcacatgaggccaagcagaagggccgtcactctggatat ggtaagcgtaggggtaccagggaggctaggctccccaccaagatcctgtg gatgcggaggatgcgcgtcctgaggcgccttctgcgcaagtaccgtgagg ccaagaagatcgacaagcacatgtaccatgacatgtacctgaaggtcaag ggtaacatgttcaagaacaagagggtcctcatggagagtatccacaagtc caaggctgagaaggcaagagagaagaccctctctgatcagtttgaggcca agcgcgccaagagcaaggcaagcagggagaggaagcatgccaggagggag gagagattggctcagggccccagagatcatgcaccagcaccagcggctgc agctccagctccagcagcagcggcaccaaagaaggccaaggccaagaagt gaaggtctgacatgaagctttanctttctggtatcatgaagggttancct gattttggagcatctgaagttcanaactgttttctgtgcaatatctgtgt gccgcgtatganataccttaaatatcatatcgtgtttgttctgttggatg ttgcttatgcanaantttctttaaa
Download
page-top